algorithms imaris oxford instruments version 10 2 0 leica x leica microsystems version 3 7 4 graphpad prism graphpad version 10 2 2 r (Oxford Instruments)
99
Structured Review
Oxford Instruments
algorithms imaris oxford instruments version 10 2 0 leica x leica microsystems version 3 7 4 graphpad prism graphpad version 10 2 2 r
Algorithms Imaris Oxford Instruments Version 10 2 0 Leica X Leica Microsystems Version 3 7 4 Graphpad Prism Graphpad Version 10 2 2 R, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+graphpad+prism+7+graphpad/Imaris/pmc11722108__mmc6-212-67-68
Average 99 stars, based on 44287 article reviews
Algorithms Imaris Oxford Instruments Version 10 2 0 Leica X Leica Microsystems Version 3 7 4 Graphpad Prism Graphpad Version 10 2 2 R, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+graphpad+prism+7+graphpad/Imaris/pmc11722108__mmc6-212-67-68
Average 99 stars, based on 44287 article reviews
algorithms imaris oxford instruments version 10 2 0 leica x leica microsystems version 3 7 4 graphpad prism graphpad version 10 2 2 r - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Mutagenesis:Article Title: PUPIL enables mapping and stamping of transient electrical connectivity in developing nervous systems. Article Snippet: HeLa ATCC CCL-2 Experimental models: Organisms/strains Mouse: ICR (CD1) Jh-LabAnimal Shjh: ICR Mouse: Cx26 flox/flox A gift from Dr. Yongchun Yu N/A (Continued on next page) Cell Reports 37, 109853, October 19, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Point mutation of CX26 F: GCCTACAC CACCAGCATCTTCTT This paper N/A Point mutation of CX26 R: GCTGGTG GTGTAGGCCCACCACAGGGACCCT TCGATA This paper N/A Recombinant DNA pCAG-CX26-PafA-IRES-EGFP This paper N/A pCAG-PafA-IRES-EGFP This paper N/A pCAG-BCCP-PupE-IRES-EGFP This paper N/A rtTA-Bi-TRE-BCCP-PupE-IRES-EGFP This paper N/A pCAG-CX26(T135A)-PafA-IRES-EGFP This paper N/A pCAG-EGFP-PupE This paper N/A pCAG-EGFP-(G4S)-PupE This paper N/A pCAG-EGFP-(G4S)3-PupE This paper N/A pCAG-EGFP-(G4S)5-PupE This paper N/A pCAG-EGFP-(G4S)9-PupE This paper N/A pCAG-CX26-PafA This paper N/A pCAG -PafA This paper N/A pCAG-EGFP 1-10-HA-(G4S)3-PupE This paper N/A pCAG-EGFP 11-myc-(G4S)3-PupE This paper N/A pCAG-GCaMP6f-(G4S)3-PupE This paper N/A pCAG-BCCP-PupE-IRES-iCre This paper N/A pCAG-CX36-PafA-IRES-EGFP This paper N/A pCAG-CX36-IRES-EGFP This paper N/A pCAG-Gephyrin-PafA-IRES-EGFP This paper N/A pCAG-CX26-BirA-IRES-EGFP This paper N/A Software and Recombinant:Article Title: PUPIL enables mapping and stamping of transient electrical connectivity in developing nervous systems. Article Snippet: HeLa ATCC CCL-2 Experimental models: Organisms/strains Mouse: ICR (CD1) Jh-LabAnimal Shjh: ICR Mouse: Cx26 flox/flox A gift from Dr. Yongchun Yu N/A (Continued on next page) Cell Reports 37, 109853, October 19, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Point mutation of CX26 F: GCCTACAC CACCAGCATCTTCTT This paper N/A Point mutation of CX26 R: GCTGGTG GTGTAGGCCCACCACAGGGACCCT TCGATA This paper N/A Recombinant DNA pCAG-CX26-PafA-IRES-EGFP This paper N/A pCAG-PafA-IRES-EGFP This paper N/A pCAG-BCCP-PupE-IRES-EGFP This paper N/A rtTA-Bi-TRE-BCCP-PupE-IRES-EGFP This paper N/A pCAG-CX26(T135A)-PafA-IRES-EGFP This paper N/A pCAG-EGFP-PupE This paper N/A pCAG-EGFP-(G4S)-PupE This paper N/A pCAG-EGFP-(G4S)3-PupE This paper N/A pCAG-EGFP-(G4S)5-PupE This paper N/A pCAG-EGFP-(G4S)9-PupE This paper N/A pCAG-CX26-PafA This paper N/A pCAG -PafA This paper N/A pCAG-EGFP 1-10-HA-(G4S)3-PupE This paper N/A pCAG-EGFP 11-myc-(G4S)3-PupE This paper N/A pCAG-GCaMP6f-(G4S)3-PupE This paper N/A pCAG-BCCP-PupE-IRES-iCre This paper N/A pCAG-CX36-PafA-IRES-EGFP This paper N/A pCAG-CX36-IRES-EGFP This paper N/A pCAG-Gephyrin-PafA-IRES-EGFP This paper N/A pCAG-CX26-BirA-IRES-EGFP This paper N/A Software and Article Title: A mechanical wave travels along a genetic guide to drive the formation of an epithelial furrow during Drosophila gastrulation. Article Snippet: Article Software:Article Title: PUPIL enables mapping and stamping of transient electrical connectivity in developing nervous systems. Article Snippet: HeLa ATCC CCL-2 Experimental models: Organisms/strains Mouse: ICR (CD1) Jh-LabAnimal Shjh: ICR Mouse: Cx26 flox/flox A gift from Dr. Yongchun Yu N/A (Continued on next page) Cell Reports 37, 109853, October 19, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Point mutation of CX26 F: GCCTACAC CACCAGCATCTTCTT This paper N/A Point mutation of CX26 R: GCTGGTG GTGTAGGCCCACCACAGGGACCCT TCGATA This paper N/A Recombinant DNA pCAG-CX26-PafA-IRES-EGFP This paper N/A pCAG-PafA-IRES-EGFP This paper N/A pCAG-BCCP-PupE-IRES-EGFP This paper N/A rtTA-Bi-TRE-BCCP-PupE-IRES-EGFP This paper N/A pCAG-CX26(T135A)-PafA-IRES-EGFP This paper N/A pCAG-EGFP-PupE This paper N/A pCAG-EGFP-(G4S)-PupE This paper N/A pCAG-EGFP-(G4S)3-PupE This paper N/A pCAG-EGFP-(G4S)5-PupE This paper N/A pCAG-EGFP-(G4S)9-PupE This paper N/A pCAG-CX26-PafA This paper N/A pCAG -PafA This paper N/A pCAG-EGFP 1-10-HA-(G4S)3-PupE This paper N/A pCAG-EGFP 11-myc-(G4S)3-PupE This paper N/A pCAG-GCaMP6f-(G4S)3-PupE This paper N/A pCAG-BCCP-PupE-IRES-iCre This paper N/A pCAG-CX36-PafA-IRES-EGFP This paper N/A pCAG-CX36-IRES-EGFP This paper N/A pCAG-Gephyrin-PafA-IRES-EGFP This paper N/A pCAG-CX26-BirA-IRES-EGFP This paper N/A Software and Article Title: A two-tier junctional mechanism drives simultaneous tissue folding and extension. Article Snippet: Article Article Title: A mechanical wave travels along a genetic guide to drive the formation of an epithelial furrow during Drosophila gastrulation. Article Snippet: Article Transmission Electron Microscopy:Article Title: PUPIL enables mapping and stamping of transient electrical connectivity in developing nervous systems. Article Snippet: HeLa ATCC CCL-2 Experimental models: Organisms/strains Mouse: ICR (CD1) Jh-LabAnimal Shjh: ICR Mouse: Cx26 flox/flox A gift from Dr. Yongchun Yu N/A (Continued on next page) Cell Reports 37, 109853, October 19, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Point mutation of CX26 F: GCCTACAC CACCAGCATCTTCTT This paper N/A Point mutation of CX26 R: GCTGGTG GTGTAGGCCCACCACAGGGACCCT TCGATA This paper N/A Recombinant DNA pCAG-CX26-PafA-IRES-EGFP This paper N/A pCAG-PafA-IRES-EGFP This paper N/A pCAG-BCCP-PupE-IRES-EGFP This paper N/A rtTA-Bi-TRE-BCCP-PupE-IRES-EGFP This paper N/A pCAG-CX26(T135A)-PafA-IRES-EGFP This paper N/A pCAG-EGFP-PupE This paper N/A pCAG-EGFP-(G4S)-PupE This paper N/A pCAG-EGFP-(G4S)3-PupE This paper N/A pCAG-EGFP-(G4S)5-PupE This paper N/A pCAG-EGFP-(G4S)9-PupE This paper N/A pCAG-CX26-PafA This paper N/A pCAG -PafA This paper N/A pCAG-EGFP 1-10-HA-(G4S)3-PupE This paper N/A pCAG-EGFP 11-myc-(G4S)3-PupE This paper N/A pCAG-GCaMP6f-(G4S)3-PupE This paper N/A pCAG-BCCP-PupE-IRES-iCre This paper N/A pCAG-CX36-PafA-IRES-EGFP This paper N/A pCAG-CX36-IRES-EGFP This paper N/A pCAG-Gephyrin-PafA-IRES-EGFP This paper N/A pCAG-CX26-BirA-IRES-EGFP This paper N/A Software and |